| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040000 |
| Chromosome: | chromosome 9 |
| Location: | 5176245 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399178 | CSN5 | (1 of 1) K09613 - COP9 signalosome complex subunit 5 [EC:3.4.-.-] (COPS5, CSN5); COP signalosome subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGCCACGCACACGGCCACACGCGCTAAC |
| Internal bar code: | AGGGTTTATGAGCGTACAATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 647 |
| LEAP-Seq percent confirming: | 82.5619 |
| LEAP-Seq n confirming: | 2069 |
| LEAP-Seq n nonconfirming: | 437 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | ACTTGTTCCACAGCAGGTCC |