Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.040093 |
Chromosome: | chromosome 12 |
Location: | 1955894 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g510400 | RBD4,CPLD30 | Conserved in the Plant Lineage and Diatoms; (1 of 4) IPR024934 - Rubredoxin-like domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCATATCATGGCGATGACATGCACGGG |
Internal bar code: | GGGATTGTGTCCAGGAGGCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 927 |
LEAP-Seq percent confirming: | 96.1378 |
LEAP-Seq n confirming: | 921 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAGCTATGTCGCACTTGA |
Suggested primer 2: | CCAACTCACGAGTCGCAGTA |