| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.040169 |
| Chromosome: | chromosome 14 |
| Location: | 1252295 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616450 | CYG46 | (1 of 2) PF00211//PF03924 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // CHASE domain (CHASE); Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCATACCGTACCTCTCGTCGCACTGCCGT |
| Internal bar code: | CACGAGAAAAGTGATCCAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 677 |
| LEAP-Seq percent confirming: | 74.7126 |
| LEAP-Seq n confirming: | 65 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGGGTAAGAACTTCTCG |
| Suggested primer 2: | ACACCTTTGCCCTTGATGAC |