| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040240 |
| Chromosome: | chromosome 6 |
| Location: | 3109336 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g275000 | paralog of LCI36; (1 of 4) K15382 - solute carrier family 50 (sugar transporter) (SLC50A, SWEET) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCCAAGCTACCAGGTCCCCAACACACG |
| Internal bar code: | TGCGCTTCGTCTAGGGGCATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 807 |
| LEAP-Seq percent confirming: | 94.8535 |
| LEAP-Seq n confirming: | 2396 |
| LEAP-Seq n nonconfirming: | 130 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTAGGATAGCCAGCACG |
| Suggested primer 2: | TGCCGTACTATTGGCTAGGG |