| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040246 |
| Chromosome: | chromosome 3 |
| Location: | 9034348 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g210177 | (1 of 3) PF13405//PF13499 - EF-hand domain (EF-hand_6) // EF-hand domain pair (EF-hand_7) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCTTGAAGTTCTTGAACGTCATGGTCAG |
| Internal bar code: | AAATCTGTGGAAGCCGCAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 681 |
| LEAP-Seq percent confirming: | 99.239 |
| LEAP-Seq n confirming: | 3260 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCATACCAGCTGCAACTCC |
| Suggested primer 2: | AGTTCTCGTGGGTATGCTGG |