Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.040252 |
Chromosome: | chromosome 7 |
Location: | 852763 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g318551 | CYA8 | Adenylate cyclase; (1 of 1) PF00211//PF13855 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Leucine rich repeat (LRR_8) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGTCCGCCGTCCGCCGCTGCTGGCCGGC |
Internal bar code: | GCAGGGTCTCGGTCCCAATCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 258 |
LEAP-Seq percent confirming: | 99.1122 |
LEAP-Seq n confirming: | 13731 |
LEAP-Seq n nonconfirming: | 123 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGTGTAAAGGTGAGCGGT |
Suggested primer 2: | GCCTTCGTGACTCTCTACCG |