Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.040255 |
Chromosome: | chromosome 17 |
Location: | 2509922 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g716200 | SUMO89B,SUM6 | Similar to Small ubiquitin-like modifier; (1 of 4) PF03171//PF11976 - 2OG-Fe(II) oxygenase superfamily (2OG-FeII_Oxy) // Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGACGTCTGGTTCCCGTCCCCTCCCCAG |
Internal bar code: | TTCAGTCGACGGTCTGATGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 130 |
LEAP-Seq percent confirming: | 97.7778 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTGCAATTCTGTGCAAT |
Suggested primer 2: | TGATGAGCCTGTGAAGCAAG |