Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.040288 |
Chromosome: | chromosome 6 |
Location: | 1745586 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g261900 | FAP71 | (1 of 7) PF07004 - Sperm-tail PG-rich repeat (SHIPPO-rpt); Flagellar Associated Protein 71 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCAGTCCACTGTGTTGGGGCTGCTACA |
Internal bar code: | CCACACGCGAATGTATGGGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 725 |
LEAP-Seq percent confirming: | 99.3969 |
LEAP-Seq n confirming: | 2802 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGACTGCGAGGTGAACAA |
Suggested primer 2: | CGCAGAAGCTGTCTGTCAAG |