Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.040324 |
Chromosome: | chromosome 1 |
Location: | 4497968 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g030600 | MAPKKK4 | (1 of 57) 2.7.10.2 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase; Mitogen-Activated Protein Kinase Kinase Kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAAGCCCAGGGCCAACGTCCGGCGGGTG |
Internal bar code: | TGGATTCACACAGTATTGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 962 |
LEAP-Seq percent confirming: | 99.1126 |
LEAP-Seq n confirming: | 3239 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAAGGTCAGCCCACTCTGCT |
Suggested primer 2: | TGCCTCAAAGACATAACCCC |