| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040405 |
| Chromosome: | chromosome 12 |
| Location: | 8645270 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g546800 | PHC53 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACGGTTTTATCAGCGTCAGCGGTGGCGT |
| Internal bar code: | TGGGCCCGTTCTGCCGGGTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 360 |
| LEAP-Seq percent confirming: | 53.4966 |
| LEAP-Seq n confirming: | 7711 |
| LEAP-Seq n nonconfirming: | 6703 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCACCTATTGCTGCCACC |
| Suggested primer 2: | GTGACGATGATTGTGTTCGG |