Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.040407 |
Chromosome: | chromosome 14 |
Location: | 2510721 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g625251 | CSV12 | Chlamydomonas-specific family protein; (1 of 1) IPR006954 - Moulting cycle MLT-10-like protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCGTACGCTGGAAGCCCCTACGCCGGCG |
Internal bar code: | TTGATACGGGCCCAATAGGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 303 |
LEAP-Seq percent confirming: | 87.7167 |
LEAP-Seq n confirming: | 2985 |
LEAP-Seq n nonconfirming: | 418 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCCATGTCTGGCAGTAGCA |
Suggested primer 2: | GGTCGCTCGTAACCGTAATG |