| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.040415 |
| Chromosome: | chromosome 17 |
| Location: | 5157970 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g735400 | VPS2B | Subunit of the ESCRT-III complex; (1 of 1) K12192 - charged multivesicular body protein 2B (CHMP2B) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCAGCGGATGCAGGGAGGCGGTTGCGAC |
| Internal bar code: | TGATTTCTAATTTTCTCCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 270 |
| LEAP-Seq percent confirming: | 99.5175 |
| LEAP-Seq n confirming: | 9488 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGGCTACAACTTCGCTTC |
| Suggested primer 2: | GTACTTGCATACCCGGCACT |