Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.040471 |
Chromosome: | chromosome 8 |
Location: | 2672228 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g373200 | FXL7 | FixL-like PAS domain protein; (1 of 11) PF13426 - PAS domain (PAS_9) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAACCGCATGGGGTGGAGAAGCAGTTTG |
Internal bar code: | GGCGTTGTTCACACCCTACTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 486 |
LEAP-Seq percent confirming: | 82.9182 |
LEAP-Seq n confirming: | 5859 |
LEAP-Seq n nonconfirming: | 1207 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGTGCGTACGTGGTGAC |
Suggested primer 2: | CTCATGTCCCACATCAATCG |