| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040534 |
| Chromosome: | chromosome 10 |
| Location: | 5548819 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g459550 | B9D2B | (1 of 1) PTHR12968:SF2 - B9 DOMAIN-CONTAINING PROTEIN 2; B9 Domain-Containing transition zone protein 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCTCATGCTACCACACGTTCGCCGGCCC |
| Internal bar code: | ATCCCACCGTCGAGGGGATGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 282 |
| LEAP-Seq percent confirming: | 99.6552 |
| LEAP-Seq n confirming: | 867 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAACCAAGGAAACAGGAGG |
| Suggested primer 2: | TCCCTGCATGATCCTTTTTC |