| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040574 |
| Chromosome: | chromosome 7 |
| Location: | 835893 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318500 | CYA8 | Putative very-long-chain fatty acid condensing enzyme; (1 of 5) 2.3.1.199 - Very-long-chain 3-oxoacyl-CoA synthase / Very-long-chain beta-ketoacyl-CoA synthase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGCGCCGCCTGGAGGGCAGGGGAGGGCA |
| Internal bar code: | GGGAGGGGGCGGACAGATAGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 759 |
| LEAP-Seq percent confirming: | 74.522 |
| LEAP-Seq n confirming: | 13876 |
| LEAP-Seq n nonconfirming: | 4744 |
| LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGAGAGATTGGAAGTTG |
| Suggested primer 2: | AGCAACAGCAACAGCAACAG |