| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.040576 |
| Chromosome: | chromosome 5 |
| Location: | 1923542 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g241633 | (1 of 2) IPR006626//IPR011050//IPR012334 - Parallel beta-helix repeat // Pectin lyase fold/virulence factor // Pectin lyase fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATGGTCTCAGGTACGCTCGGCTTGACT |
| Internal bar code: | GGTCCAACGTGGCGCGGTTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 447 |
| LEAP-Seq percent confirming: | 38.2265 |
| LEAP-Seq n confirming: | 1539 |
| LEAP-Seq n nonconfirming: | 2487 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAATGTCAATGGCCTCCT |
| Suggested primer 2: | GTGCGCTACAGCCTCTCTCT |