| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.040601 |
| Chromosome: | chromosome 10 |
| Location: | 2438766 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435800 | CSP41b,CSP41B,SNE11,RAP38 | Chloroplast stem-loop-binding protein 41b; (1 of 1) PTHR10366:SF289 - CHLOROPLAST STEM-LOOP BINDING PROTEIN OF 41 KDA B, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAATTAGGCCCTGCCACCCCGCCCTTGG |
| Internal bar code: | GGCTGCCGCCCCAGCCCTGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 225 |
| LEAP-Seq percent confirming: | 86.2796 |
| LEAP-Seq n confirming: | 3314 |
| LEAP-Seq n nonconfirming: | 527 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCTCACACATTCACGAC |
| Suggested primer 2: | AATCCACTACAACGCCAAGG |