Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.040746 |
Chromosome: | chromosome 17 |
Location: | 498546 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g699350 | SMM51 | (1 of 13) PF12847 - Methyltransferase domain (Methyltransf_18); S-adenosyl-L-methionine-dependent methyltransferase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCGCCGGCACCCCCGCCACTGCCGCT |
Internal bar code: | ATCGTCGGGAACTTTGGTTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 267 |
LEAP-Seq percent confirming: | 95.9248 |
LEAP-Seq n confirming: | 612 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACTTCGTGAGAGACCCAGC |
Suggested primer 2: | AAGCACAATCAAGGTGGGTC |