| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040793 |
| Chromosome: | chromosome 7 |
| Location: | 5695178 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g352550 | RDP3 | Putative rhodanese domain phosphatase; (1 of 3) K18065 - Cdc25 family phosphatase [EC:3.1.3.48 1.20.4.-] (CDC25) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTAGGCATTGGATTGGTCGAGCAACTGG |
| Internal bar code: | ATTCGATGGATCCACTGCACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 904 |
| LEAP-Seq percent confirming: | 98.4882 |
| LEAP-Seq n confirming: | 5277 |
| LEAP-Seq n nonconfirming: | 81 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTTGGCTCTTGTAACCCC |
| Suggested primer 2: | GGCTCATTACTTCGGCTGAG |