| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.040951 |
| Chromosome: | chromosome 16 |
| Location: | 5038748 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684500 | TNP43,CSB62 | (1 of 70) PF07282 - Putative transposase DNA-binding domain (OrfB_Zn_ribbon); {"Probable transposon-derived protein of Chlamydomonas-Specific family B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATGAGCCGCCCTGTCGGCGCGCGCCCG |
| Internal bar code: | AGTGCATACGACGTACAAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 11 |
| LEAP-Seq percent confirming: | 95.5466 |
| LEAP-Seq n confirming: | 236 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCCGTCATAAAGAGCCTG |
| Suggested primer 2: | CAAACAAACTGGGAGGCAAT |