| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.040978 |
| Chromosome: | chromosome 6 |
| Location: | 3560235 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278117 | CPLD7 | Conserved in the Plant Lineage and Diatoms; (1 of 98) IPR023214 - HAD-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCGCAATGAGCTTCTGCTGTGTCGGCGCG |
| Internal bar code: | GGGACGCCTGGGACTACCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 904 |
| LEAP-Seq percent confirming: | 99.6506 |
| LEAP-Seq n confirming: | 9126 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGTCCACATCACACGGAC |
| Suggested primer 2: | TGGTTGTGGTTGGAAGTGAA |