Insertion junction: LMJ.RY0402.040984_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.040984
Chromosome:chromosome_6
Location:7919001
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g303400 FAP16 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCGCACAACACTCATCGACAAGGCCTTAT
Internal bar code:GAGGTGTATGAGCGGGGGCGTC

Confirmation - LEAP-Seq

LEAP-Seq distance:50
LEAP-Seq percent confirming:2.97177
LEAP-Seq n confirming:300
LEAP-Seq n nonconfirming:9795
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:ATGAGTTTACAGCATCCCCG
Suggested primer 2:ATAGCGGAGGATGTGGATGA