| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.041062 |
| Chromosome: | chromosome 1 |
| Location: | 5891237 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g042000 | (1 of 1) PF00023//PF00612//PF13637//PF13857 - Ankyrin repeat (Ank) // IQ calmodulin-binding motif (IQ) // Ankyrin repeats (many copies) (Ank_4) // Ankyrin repeats (many copies) (Ank_5) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCACTCCCAGGCTGACGGCGGTGGAGG |
| Internal bar code: | AGGCGATAACCGGGGTGAGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 47 |
| LEAP-Seq percent confirming: | 98.6487 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATACCCACACCCACCTACC |
| Suggested primer 2: | CAGGCTGCCACTCAGATACA |