| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.041069 |
| Chromosome: | chromosome 5 |
| Location: | 2750716 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g236907 | (1 of 1) IPR000572//IPR014720 - Oxidoreductase, molybdopterin-binding domain // Double-stranded RNA-binding domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTCATCTTGACCCTGCCGTAGGTGGCG |
| Internal bar code: | TGGCCGGCCAGGTGCCCGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 244 |
| LEAP-Seq percent confirming: | 98.5294 |
| LEAP-Seq n confirming: | 536 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAAGGGCTGGATCATCAC |
| Suggested primer 2: | AGTAGGCACCATACGGCATC |