| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.041079 |
| Chromosome: | chromosome 1 |
| Location: | 4018472 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g026100 | RPP14,XRP14 | (1 of 1) K03537 - ribonuclease P/MRP protein subunit POP5 (POP5); Ribonuclease MRP subunit P14 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTATGCACACCCCTGCCTGCCCCTGCAC |
| Internal bar code: | GGTGAGGATAGGACTGGGAACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 867 |
| LEAP-Seq percent confirming: | 99.6023 |
| LEAP-Seq n confirming: | 3506 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAAGCAGTGCCAGCGTATG |
| Suggested primer 2: | CTATTGAAAGCCTGCGCTTC |