Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.041121 |
Chromosome: | chromosome 10 |
Location: | 2313078 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g434726 | (1 of 1) K15163 - mediator of RNA polymerase II transcription subunit 12, fungi type (SRB8, MED12) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTTTTAGCGTCGAAGACGTTTTCTGTCC |
Internal bar code: | GGCGTCTGGCGCCCTTCCCGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 934 |
LEAP-Seq percent confirming: | 98.0815 |
LEAP-Seq n confirming: | 4141 |
LEAP-Seq n nonconfirming: | 81 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGAAAATTATGTAGCGGGC |
Suggested primer 2: | GCTTGTCTGCTGTCCACAAA |