Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.041137 |
Chromosome: | chromosome 1 |
Location: | 1712656 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g009200 | POB29 | Proteome of basal body 29; (1 of 2) IPR002083//IPR008974 - MATH/TRAF domain // TRAF-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAATGAGCGGCGGGGGTGTCTTGGGGCCG |
Internal bar code: | GTTACCGGTCTACTCGACCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 273 |
LEAP-Seq percent confirming: | 99.7481 |
LEAP-Seq n confirming: | 2772 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGTGAGAGCTTGCATTCC |
Suggested primer 2: | ACACAGTACCGTGAGAGGGG |