| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.041232 |
| Chromosome: | chromosome 6 |
| Location: | 2954949 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273050 | CGLD10 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR35279//PTHR35279:SF1 - FAMILY NOT NAMED // ARABINANASE/LEVANSUCRASE/INVERTASE | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGTGGAGGGGCTGCGCATGCGGCCCGG |
| Internal bar code: | CCAAGGGACGCTGAGCGCGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 793 |
| LEAP-Seq percent confirming: | 98.0711 |
| LEAP-Seq n confirming: | 1932 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACGCCATCTGGAACAAAG |
| Suggested primer 2: | CCCTTCTTGGTCCACTTGAA |