| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.041256 |
| Chromosome: | chromosome 16 |
| Location: | 2355060 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g659750 | CEP15 | Cysteine endopeptidase; (1 of 3) 3.4.18.1 - Cathepsin X / Lysosomal carboxypeptidase B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTGGTGCGCGCGGTAGTGCAAGGGCCAT |
| Internal bar code: | TCAACGGAAGGGTCCATGCCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 878 |
| LEAP-Seq percent confirming: | 96.6991 |
| LEAP-Seq n confirming: | 6064 |
| LEAP-Seq n nonconfirming: | 207 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGTTGCACTCAACCACCA |
| Suggested primer 2: | TTTTTCGCCAATTACGGAAC |