| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.041263 |
| Chromosome: | chromosome 3 |
| Location: | 8143871 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g200600 | KIN14A1,KIN14A-1,KIN14-4 | Kinesin motor protein; (1 of 2) K10405 - kinesin family member C1 (KIFC1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCTCTTCAGCGCAGCCCACCAGCTCGG |
| Internal bar code: | GGGGCACATCTCTGAGATGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 970 |
| LEAP-Seq percent confirming: | 99.5355 |
| LEAP-Seq n confirming: | 4286 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGACAGTGACACCGATGG |
| Suggested primer 2: | CCTGAACCCTACTGCACCAT |