| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.041284 |
| Chromosome: | chromosome 12 |
| Location: | 5567110 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531600 | EIF5Bd | (1 of 1) K13690 - alpha-1,3-mannosyltransferase [EC:2.4.1.-] Man a1-3 Man (CMT1); putative translation initiation factor eIF-2 beta chain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGTATTCATCAACGACGTCTTCTTCGCC |
| Internal bar code: | ACCGTGGGCGCGGTACGTTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 438 |
| LEAP-Seq percent confirming: | 97.2031 |
| LEAP-Seq n confirming: | 2259 |
| LEAP-Seq n nonconfirming: | 65 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTACCGATATGTGAGGCA |
| Suggested primer 2: | AGCAGCAGTACACCTCGGTT |