| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.041341 |
| Chromosome: | chromosome 6 |
| Location: | 3223813 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g276150 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACTTAGCAATATTCACTCGCATACCAAA |
| Internal bar code: | CAGCCTTACCGAGATGAGAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 187 |
| LEAP-Seq percent confirming: | 24.7674 |
| LEAP-Seq n confirming: | 772 |
| LEAP-Seq n nonconfirming: | 2345 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGTGCTTTGTCGAACAGG |
| Suggested primer 2: | TGCTGTTTTCAGTTGCAAGG |