| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.041448 |
| Chromosome: | chromosome 10 |
| Location: | 2537363 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436650 | HEL45 | (1 of 1) PTHR24031//PTHR24031:SF181//PTHR24031:SF50 - RNA HELICASE // DEAD-BOX ATP-DEPENDENT RNA HELICASE 50 // DEAD/DEAH BOX RNA HELICASE FAMILY PROTEIN; DEAD/DEAH box helicase-related protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCGGCTGCTCACTCAAGCAAAGGTGCG |
| Internal bar code: | TCCCACTGTCCACGAAGTGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 443 |
| LEAP-Seq percent confirming: | 95.1613 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCACTTTGGGTTTGCTTT |
| Suggested primer 2: | ACACGGTGGAGACTTTGGAC |