Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.041489 |
Chromosome: | chromosome 10 |
Location: | 3898105 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g447800 | (1 of 3) K11089 - 60 kDa SS-A/Ro ribonucleoprotein (TROVE2, SSA2) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACAAAGTTCTGTGCGTCGGGCCAAAGGC |
Internal bar code: | GTATACGCGACCTCAACGTCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 755 |
LEAP-Seq percent confirming: | 98.9147 |
LEAP-Seq n confirming: | 2552 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTGTGCACTTGACACGTT |
Suggested primer 2: | GTCCCTTAGGTGAATGCGAA |