| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.041545 |
| Chromosome: | chromosome 6 |
| Location: | 2958354 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273100 | (1 of 3) PF03067 - Chitin binding domain (Chitin_bind_3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGGGTGATCTCCGCATCACTGGGCTTC |
| Internal bar code: | TTCTCAGGCGCTTGTACCTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1080 |
| LEAP-Seq percent confirming: | 94.7779 |
| LEAP-Seq n confirming: | 40019 |
| LEAP-Seq n nonconfirming: | 2205 |
| LEAP-Seq n unique pos: | 92 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTCATGACCCCCAATGAC |
| Suggested primer 2: | CTAGGCCTTCTTGGCCTTCT |