Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.041603 |
Chromosome: | chromosome 5 |
Location: | 2469844 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g235550 | OPR125 | OctotricoPeptide Repeat protein 125; (1 of 3) IPR016030 - Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase-like | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTCAGGTCCCGGGCGGCGTCGGCGCTG |
Internal bar code: | GAGACCGCAGGGGGGAGCAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 357 |
LEAP-Seq percent confirming: | 98.3206 |
LEAP-Seq n confirming: | 644 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAAGCTCTGCAGCTCCTC |
Suggested primer 2: | AGATGGTAGTGGATGCCAGG |