| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.041715 |
| Chromosome: | chromosome 12 |
| Location: | 1901061 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g511050 | RSP16 | Radial Spoke Protein 16; (1 of 1) K09519 - DnaJ homolog subfamily B member 13 (DNAJB13) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGCAGGCCCGGCTTGACGTCCACGGTG |
| Internal bar code: | GCGCTGGGTGAGTGATACGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 210 |
| LEAP-Seq percent confirming: | 98.2155 |
| LEAP-Seq n confirming: | 2807 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTCTGCATCTAGTCAGCC |
| Suggested primer 2: | AGTCTGAATGTGCATGAGCG |