| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.041788 |
| Chromosome: | chromosome 9 |
| Location: | 6551299 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407900 | RRM8 | (1 of 1) PTHR11061//PTHR11061:SF15 - RNA M5U METHYLTRANSFERASE FAMILY // SUBFAMILY NOT NAMED; Putative rRNA (guanine-N2-)-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACCAGAGTGGTACCCGCGTGAGTAGGCC |
| Internal bar code: | CGCCGCGTGGGTTTCGGCAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 910 |
| LEAP-Seq percent confirming: | 95.2777 |
| LEAP-Seq n confirming: | 172427 |
| LEAP-Seq n nonconfirming: | 8546 |
| LEAP-Seq n unique pos: | 152 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCGAAGTCGAAATGCTAA |
| Suggested primer 2: | TGGTGTTGCTTGATGTTGGT |