Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.041874 |
Chromosome: | chromosome 3 |
Location: | 6017732 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g190950 | TUA1 | (1 of 2) K07374 - tubulin alpha (TUBA); Alpha tubulin 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCGGCAACGACGTCCCAGCGCGCTCTCG |
Internal bar code: | TCCCTTTATATTTATCTGCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 896 |
LEAP-Seq percent confirming: | 97.541 |
LEAP-Seq n confirming: | 119 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCGTGAGAATTGTCTGGCA |
Suggested primer 2: | AAGGGTACGAAAACTGGGCT |