Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.041929 |
Chromosome: | chromosome 3 |
Location: | 1127235 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g149050 | (1 of 1) PF03188//PF13415 - Eukaryotic cytochrome b561 (Cytochrom_B561) // Galactose oxidase, central domain (Kelch_3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATTTATGGGCCTTGCGTGGGGCATACTG |
Internal bar code: | GTTCCAGGTCGCCGGTTGTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 967 |
LEAP-Seq percent confirming: | 99.4437 |
LEAP-Seq n confirming: | 9116 |
LEAP-Seq n nonconfirming: | 51 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTACGTGTGGACCATCCTT |
Suggested primer 2: | GGAACGTGCAGTCCTCTCTC |