| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.041994 |
| Chromosome: | chromosome 5 |
| Location: | 2781134 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g237050 | CGLD27 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR34214:SF3 - GB|AAC18972.1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGGCGCGGGGGCCAGTGTGGGGCCGCC |
| Internal bar code: | GAACGACCAGTGGTGTGTTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 581 |
| LEAP-Seq percent confirming: | 99.0202 |
| LEAP-Seq n confirming: | 9096 |
| LEAP-Seq n nonconfirming: | 90 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATCCCTTGGCCATATTCC |
| Suggested primer 2: | CTGGCTCGAAGGTCTGGTAG |