| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.042145 |
| Chromosome: | chromosome 9 |
| Location: | 6124971 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g405150 | PUS1 | RNA pseudouridine synthase; (1 of 2) PTHR11142//PTHR11142:SF0 - PSEUDOURIDYLATE SYNTHASE // TRNA PSEUDOURIDINE SYNTHASE-LIKE 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTTGATGGATCACTGCCGCTGCCTTGC |
| Internal bar code: | TGCCGGCTAGTCCATCATTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 371 |
| LEAP-Seq percent confirming: | 98.8185 |
| LEAP-Seq n confirming: | 10204 |
| LEAP-Seq n nonconfirming: | 122 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCGTGGTCTAAGCAGATT |
| Suggested primer 2: | ATCCATCCACCCATCCAGTA |