Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.042155 |
Chromosome: | chromosome 11 |
Location: | 1560425 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467756 | MMP5 | Metalloproteinase of VMP family; (1 of 51) PF05548 - Gametolysin peptidase M11 (Peptidase_M11) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGCGTTGCCTTGTGCGCTGAGAGCCGT |
Internal bar code: | GAGGTGCATCCGGCGCGCGACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1088 |
LEAP-Seq percent confirming: | 99.4503 |
LEAP-Seq n confirming: | 6151 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCCAAGTCGGTAAGTGTCC |
Suggested primer 2: | TACCAGCCGGTACAACCTTC |