| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.042157 |
| Chromosome: | chromosome 9 |
| Location: | 2144219 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393450 | FAS10,FAP233,FLA5 | Flagellar Associated Protein 233; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGTGCGGAAGCCCTGCACACACACAGT |
| Internal bar code: | GAGGCCTGGACTGACCGCAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 238 |
| LEAP-Seq percent confirming: | 99.7262 |
| LEAP-Seq n confirming: | 1821 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACACCCCCTTTTCTCTTG |
| Suggested primer 2: | CCTAGTCGTGTTGCCCAAAT |