| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.042194 |
| Chromosome: | chromosome 9 |
| Location: | 7050694 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g411400 | MOT45 | PF13 protein required for dynein inner/outer arm assembly in the | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTACGCATGTACATACATGTTCTTGGCAA |
| Internal bar code: | GGAATGGCCTCTTCGTAGCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 898 |
| LEAP-Seq percent confirming: | 86.5158 |
| LEAP-Seq n confirming: | 1912 |
| LEAP-Seq n nonconfirming: | 298 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACGCACACTGCACACGTA |
| Suggested primer 2: | CGCTTTGGAAAGAAGGTCTG |