| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.042223 |
| Chromosome: | chromosome 7 |
| Location: | 4408168 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340950 | AXL4 | (1 of 6) PTHR10994//PTHR10994:SF61 - RETICULON // RETICULON-LIKE PROTEIN; Arabinose chain extension enzyme like protein 4 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGTTCAGTCTGTCGTCGACCGCGCCATA |
| Internal bar code: | TGCTACTTTCGCCTTCGTAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 800 |
| LEAP-Seq percent confirming: | 98.4334 |
| LEAP-Seq n confirming: | 377 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCATGTACTCAGGATCGGT |
| Suggested primer 2: | ATGACCTGGCTGAACAGGAC |