Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.042227 |
Chromosome: | chromosome 12 |
Location: | 2176920 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g508644 | HDG1 | (1 of 1) PTHR11850//PTHR11850:SF132 - HOMEOBOX PROTEIN TRANSCRIPTION FACTORS // BEL1-LIKE HOMEODOMAIN PROTEIN 11; BELL-related homeodomain protein | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGATTGTGCCATGCTACATACACCTACA |
Internal bar code: | TGGTTCAGTGCAGTAACCAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1011 |
LEAP-Seq percent confirming: | 99.3575 |
LEAP-Seq n confirming: | 3402 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGTCTGTGGCTGCTACTGC |
Suggested primer 2: | ACTGGCAACCAAACAGCTTC |