| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.042231 |
| Chromosome: | chromosome 16 |
| Location: | 5946903 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677001 | (1 of 1) PTHR31596:SF1 - T-CELL ACTIVATION INHIBITOR, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAACCCCTCCCCCCACACACGTACCTG |
| Internal bar code: | CGAAGGGGCCATCGCCAATAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 98.6704 |
| LEAP-Seq n confirming: | 1410 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGGGTGTTTACGTGTGCT |
| Suggested primer 2: | AAGGTGGAACTCACACTGCC |