| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.042253 |
| Chromosome: | chromosome 1 |
| Location: | 926093 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005001 | CPLD9 | Conserved in the Plant Lineage and Diatoms | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCCGTCAAACCGTTACAGGCTTACAGCA |
| Internal bar code: | TTGAATCCAGTTTGTGTGCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 851 |
| LEAP-Seq percent confirming: | 99.0586 |
| LEAP-Seq n confirming: | 2315 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATAGCAGCCGAACCTTCA |
| Suggested primer 2: | ATCCACAGAATCATCCGCTC |