| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.042348 |
| Chromosome: | chromosome 17 |
| Location: | 2113213 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g712400 | TERC1,TERC | Thylakoid protein integration factor; (1 of 1) PTHR30238:SF0 - PROTEIN PIGMENT DEFECTIVE 149 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCACAGCGCGCGAGTGGTCAGCAACGT |
| Internal bar code: | AGTGTATTCTAGAGGCGTTCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 200 |
| LEAP-Seq percent confirming: | 99.758 |
| LEAP-Seq n confirming: | 2473 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTTCTCCAGGTTGTCCAT |
| Suggested primer 2: | GAAGTTGGTGCCGTCGTATT |